rgs8

Ensembl ID:
ENSDARG00000070037
ZFIN ID:
ZDB-GENE-040718-264
Description:
Regulator of G-protein signaling 8 [Source:UniProtKB/Swiss-Prot;Acc:Q6DGI0]
Human Orthologue:
RGS18
Human Description:
regulator of G-protein signaling 18 [Source:HGNC Symbol;Acc:14261]
Mouse Orthologue:
Rgs18
Mouse Description:
regulator of G-protein signaling 18 Gene [Source:MGI Symbol;Acc:MGI:1927498]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25342 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102461 Nonsense 83 174 5 6
Genomic Location (Zv9):
Chromosome 6 (position 34280867)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 35482620
KASP Assay ID:
554-7618.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGTTCAGTGATGAAAACATTGAGTTCTGGTTGGCCTGTGAGGACTAT[A/T]AAAAGATCAAATCCCCTGCTAAGATGATGTCCAAGGCCAATAAGATCTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link