ehhadh

Ensembl ID:
ENSDARG00000070029
ZFIN ID:
ZDB-GENE-040426-2581
Description:
Peroxisomal bifunctional enzymeEnoyl-CoA hydratase/3,2-trans-enoyl-CoA isomerase3-hydroxyacyl-CoA de
Human Orthologue:
EHHADH
Human Description:
enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase [Source:HGNC Symbol;Acc:3247]
Mouse Orthologue:
Ehhadh
Mouse Description:
enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2485 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102434 Essential Splice Site 59 718 2 7
Genomic Location:
Chromosome 9 (position 12719229)
KASP Assay ID:
554-2591.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGGTCACGGCTGTGGTGATCTGTGGAGAGAATGGGCGATTCTGTGGAG[G/A]TWAGTATATAAAACCAAAAACAAAAGATTGCTTTTCTRTGAAATCTGTCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/czl8n7fm