DCHS1 (2 of 2)

Ensembl ID:
ENSDARG00000070025
Description:
dachsous 1 (Drosophila) [Source:HGNC Symbol;Acc:13681]
Human Orthologue:
DCHS1
Human Description:
dachsous 1 (Drosophila) [Source:HGNC Symbol;Acc:13681]
Mouse Orthologue:
Dchs1
Mouse Description:
dachsous 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2685011]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35933 Nonsense Mutation detected in F1 DNA During 2017
sa9209 Nonsense Mutation detected in F1 DNA During 2017
sa15468 Nonsense Available for shipment Available now
sa35934 Nonsense Mutation detected in F1 DNA During 2017
sa42580 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22684 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102424 Nonsense 747 3246 4 21
Genomic Location (Zv9):
Chromosome 15 (position 31393861)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32289513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGGGTCAACATCAGTATAGTGGCGGGACTGGTCGCACCCCCTGTATTT[G/T]AGCAAGCTCAGTACTACTTTGTGGTCTCAGAGGATGCCCTGCGTGGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9209
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102424 Nonsense 960 3246 5 21
Genomic Location (Zv9):
Chromosome 15 (position 31394896)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32290548
KASP Assay ID:
2260-8736.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGTACAAGCTGAAAATGGACAAGGCCCTGTGTTTGATAGCCTCACATA[C/A]AGAGTAGAGCTAAAGGAAAGCACCCCRCTTAACACACGCTTTCTACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15468
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102424 Nonsense 978 3246 5 21
Genomic Location (Zv9):
Chromosome 15 (position 31394948)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32290600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTAGAGCTAAAGGAAAGCACCCCRCTTAACACACGCTTTCTACAGGTC[C/T]GAGCTGTGAACCGAGATGGTGGCATCACCACTGGMCTGTCATCWAMTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102424 Nonsense 1674 3246 12 21
Genomic Location (Zv9):
Chromosome 15 (position 31428471)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32324123
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTTCAGTATTCATCCGGTGACAGGAGTCATAACTACCACCAAAGCTT[T/A]GGATAGGGAGGCCCAAGGCGTTTATGCTTTGACAGGTACTGAAGTGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42580
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102424 Essential Splice Site 2044 3246 14 21
Genomic Location (Zv9):
Chromosome 15 (position 31431130)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32326782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTCGCGCAACACTAGAGATGTGAGCCTGCAGGAAAATGCAGCCAAAG[G/A]TGGGATGATGATCTCTGAATTCAATACAGATATGTTAAAGAGCCCCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22684
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102424 Nonsense 2301 3246 19 21
Genomic Location (Zv9):
Chromosome 15 (position 31437318)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32332970
KASP Assay ID:
2260-8740.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATACACCGTTATGGAGGAGGGGTGTCCCTTACTACCCCTCTGGACTTT[G/T]AGATTAAAACATGGTACACACTGACAGTCAGCTCTTCAGACTCCAAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link