si:dkey-108d22.5

Ensembl ID:
ENSDARG00000070015
ZFIN ID:
ZDB-GENE-041210-89
Description:
Novel protein similar to pim oncogene family [Source:UniProtKB/TrEMBL;Acc:Q1LX85]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16211 Nonsense Available for shipment Available now
sa33408 Essential Splice Site Mutation detected in F1 DNA During 2017
sa7318 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16211
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067272 Nonsense 6 288 1 6
ENSDART00000136981   None 123 None 4
ENSDART00000140018 Nonsense 12 281 1 5
Genomic Location (Zv9):
Chromosome 4 (position 10468350)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11404977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTTATTTTTTAACAGACATCATTTTAAGGCATTACAAAATTGGTGAC[A/T]AGCTGGGCAAAGGTGGATTCGGCTCTGTCTACAAAGSCACACGCCGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067272 Essential Splice Site 169 288 3 6
ENSDART00000136981   None 123 None 4
ENSDART00000140018 Essential Splice Site 175 281 3 5
Genomic Location (Zv9):
Chromosome 4 (position 10467245)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11403872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCGGCTGTGGTGCGATCGCAAAGGAATCAGGCTACAAAGTCTTCTGTG[G/C]TAAGTGTTATGAACTTTGTTGTCATAAAAATAACATACTAAAGATTCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067272 Nonsense 233 288 5 6
ENSDART00000136981 Nonsense 94 123 3 4
ENSDART00000140018   None 281 None 5
Genomic Location (Zv9):
Chromosome 4 (position 10466618)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11403245
KASP Assay ID:
554-4935.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAACTATYACCCTTAAACACCCCATTCTTCTTTCTGCACAGAATGCTGC[C/T]RGATGATCTGCGGTTGTCTGCAGCCAGACCCAGATGAGAGACTCGCTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link