dmrt2b

Ensembl ID:
ENSDARG00000070013
ZFIN ID:
ZDB-GENE-080813-1
Description:
doublesex and mab-3 related transcription factor 2b [Source:RefSeq peptide;Acc:NP_001073445]
Human Orthologue:
DMRT2
Human Description:
doublesex and mab-3 related transcription factor 2 [Source:HGNC Symbol;Acc:2935]
Mouse Orthologue:
Dmrt2
Mouse Description:
doublesex and mab-3 related transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:1330307]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31524 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31524
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102391 Nonsense 253 364 3 3
Genomic Location (Zv9):
Chromosome 6 (position 35606226)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 34231021
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCTAGACACACTGACAGATGACGTCTCTCTGAGAGTGTGCAAGAATT[G/A]GGACATTTTCAGTTCCATTCAGTCCCCATTGCAATGTTACAACAGCACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link