Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-167j6.4
- Ensembl ID:
- ENSDARG00000070011
- ZFIN ID:
- ZDB-GENE-070912-146
- Human Orthologue:
- ASTL
- Human Description:
- astacin-like metallo-endopeptidase (M12 family) [Source:HGNC Symbol;Acc:31704]
- Mouse Orthologue:
- Astl
- Mouse Description:
- astacin-like metalloendopeptidase (M12 family) Gene [Source:MGI Symbol;Acc:MGI:3046414]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa6109 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa21445 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa6109
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000102386 | Essential Splice Site | 232 | 276 | 7 | 8 |
| ENSDART00000146477 | Essential Splice Site | 173 | 213 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 9 (position 13169839)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 12922404 GRCz11 9 12893607 - KASP Assay ID:
- 554-3787.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AACAATTTGGACACCCCGTACGACTACAGCTCTGTGATGCACTTTGGAAA[G/A]TAAGTCAACATTCATTTGAAATGATAACTGAAGAGATGTTTNAAAAGTGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21445
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000102386 | Essential Splice Site | 232 | 276 | 7 | 8 |
| ENSDART00000146477 | Essential Splice Site | 173 | 213 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 9 (position 13169840)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 12922405 GRCz11 9 12893608 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAATTTGGACACCCCGTACGACTACAGCTCTGTGATGCACTTTGGAAAG[T/C]AAGTCAACATTCATTTGAAATGATAACTGAAGAGATGTTTAAAAAGTGCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
