si:ch211-167j6.4

Ensembl ID:
ENSDARG00000070011
ZFIN ID:
ZDB-GENE-070912-146
Human Orthologue:
ASTL
Human Description:
astacin-like metallo-endopeptidase (M12 family) [Source:HGNC Symbol;Acc:31704]
Mouse Orthologue:
Astl
Mouse Description:
astacin-like metalloendopeptidase (M12 family) Gene [Source:MGI Symbol;Acc:MGI:3046414]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6109 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21445 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6109
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102386 Essential Splice Site 232 276 7 8
ENSDART00000146477 Essential Splice Site 173 213 4 5
Genomic Location (Zv9):
Chromosome 9 (position 13169839)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12922404
KASP Assay ID:
554-3787.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAATTTGGACACCCCGTACGACTACAGCTCTGTGATGCACTTTGGAAA[G/A]TAAGTCAACATTCATTTGAAATGATAACTGAAGAGATGTTTNAAAAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21445
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102386 Essential Splice Site 232 276 7 8
ENSDART00000146477 Essential Splice Site 173 213 4 5
Genomic Location (Zv9):
Chromosome 9 (position 13169840)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12922405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAATTTGGACACCCCGTACGACTACAGCTCTGTGATGCACTTTGGAAAG[T/C]AAGTCAACATTCATTTGAAATGATAACTGAAGAGATGTTTAAAAAGTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link