rcn1

Ensembl ID:
ENSDARG00000070006
ZFIN ID:
ZDB-GENE-080225-33
Human Orthologue:
RCN1
Human Description:
reticulocalbin 1, EF-hand calcium binding domain [Source:HGNC Symbol;Acc:9934]
Mouse Orthologue:
Rcn1
Mouse Description:
reticulocalbin 1 Gene [Source:MGI Symbol;Acc:MGI:104559]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25356 Nonsense Mutation detected in F1 DNA During 2017
sa20882 Nonsense Available for shipment Available now
sa1699 Essential Splice Site F2 line generated During 2017
sa20881 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25356
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102363 Nonsense 124 328 2 6
Genomic Location (Zv9):
Chromosome 7 (position 16595617)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15578315
KASP Assay ID:
554-7505.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAGAAGCGCTACGTTTATGAGAACGTTGCAAAAGTCTGGACTGACTA[T/A]GACCTGAACAAAGACAACAAGATCTCTTGGGATGAATACAAGCAGGCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102363 Nonsense 273 328 5 6
Genomic Location (Zv9):
Chromosome 7 (position 16592575)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15575273
KASP Assay ID:
2259-8550.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAAGATGGGAAGATGGACCTAGAAGAGATTCGTCACTGGATCCTGCCA[C/T]AGGACTATGATCACGCACAGGCAGAAGCCAGACATCTGGTGTACGAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1699
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102363 Essential Splice Site 293 328 5 6
Genomic Location (Zv9):
Chromosome 7 (position 16592511)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15575209
KASP Assay ID:
554-1645.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCACAGGCAGAAGCCAGACATCTGGTGTACGAGTCAGACACAGACAAAG[T/A]AAGAACGGGCTAGGATACTGTTAAGAATGGTTTCYAAAACAACCTTGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102363 Nonsense 317 328 6 6
Genomic Location (Zv9):
Chromosome 7 (position 16589048)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15571746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATACTTGAGAACTGGAACATGTTTGTTGGCAGCCAAGCCACCAACTA[C/A]GGTGAAGACCTTACCAGGAACCACGATGAGCTCTGAGCCCAACTGACCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link