elna

Ensembl ID:
ENSDARG00000069994
ZFIN ID:
ZDB-GENE-061212-1
Description:
elastin a [Source:RefSeq peptide;Acc:NP_001073532]
Human Orthologue:
ELN
Human Description:
elastin [Source:HGNC Symbol;Acc:3327]
Mouse Orthologue:
Eln
Mouse Description:
elastin Gene [Source:MGI Symbol;Acc:MGI:95317]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12235 Nonsense Available for shipment Available now
sa17177 Nonsense Available for shipment Available now
sa42459 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42460 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11039 Essential Splice Site Available for shipment Available now
sa42461 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32006 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12235
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Nonsense 3 1079 1 52
Genomic Location (Zv9):
Chromosome 15 (position 163469)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 386803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGANTTTTCTTTGAATCTGTTGCTACATATCTCTCTGGCTGTAGGTGGATA[T/A]GGGGGTTATGGTGGATATGGTGGTGCTGGAAGATTCTACCCAATGGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17177
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Nonsense 13 1079 1 52
Genomic Location (Zv9):
Chromosome 15 (position 163497)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 386775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCTGGCTGTAGGTGGATAWGGGGGTTATGGTGGATATGGTGGTGCT[G/T]GAAGATTCTACCCAATGGCTGGAGGTCTGAAACCAGCTAAATCAGGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Essential Splice Site 558 1079 24 52
Genomic Location (Zv9):
Chromosome 15 (position 173902)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 376370
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGTGCTGGTGCACTCTCCCCTGCTCAGGCAAAAGCTGCTAAATATGG[T/A]AAGCATGCATATTAACTGATGTACCAGTGTTAATTAATTATGACCAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42460
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Essential Splice Site 710 1079 31 52
Genomic Location (Zv9):
Chromosome 15 (position 176873)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 373399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTGAATGCTTTCAGGGCTAGCAGCTGGAGCCAAACCTCCTAAATATG[G/A]TAAGGGCTTGACTCTTTTCTGTTTCAGCTGTCTTGGCAGTGTTATTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Essential Splice Site 992 1079 46 52
Genomic Location (Zv9):
Chromosome 15 (position 185411)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 364861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGAGCGGGTGGTGTTGGMRGTGTTGGAGGACTSTATCCWGGAGCAG[G/A]TGAGACTTCATGCTAAACATCAGCACTTCACATATAATGTTGTGCATRGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42461
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Essential Splice Site 1034 1079 49 52
Genomic Location (Zv9):
Chromosome 15 (position 188977)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 361295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTTCTCTGCAGGCGGTGTAGCTGCTGGAGGATACGGAGCTTATCCAG[G/A]TAATGCTTTAGTGAAATAATAATACAACATATAACACAGTGTCTTCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32006
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Nonsense 1038 1079 50 52
Genomic Location (Zv9):
Chromosome 15 (position 190497)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 359775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAGTTAGACTCATCTCTCTCCTCTGTTTCTGTGTTTCAGGAGGATAT[G/T]GAGCAGGACTATCCCCACAGCAGGGTACGACCTCTACATAACGCACCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link