elna

Ensembl ID:
ENSDARG00000069994
ZFIN ID:
ZDB-GENE-061212-1
Description:
elastin a [Source:RefSeq peptide;Acc:NP_001073532]
Human Orthologue:
ELN
Human Description:
elastin [Source:HGNC Symbol;Acc:3327]
Mouse Orthologue:
Eln
Mouse Description:
elastin Gene [Source:MGI Symbol;Acc:MGI:95317]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12235 Nonsense Available for shipment Available now
sa17177 Nonsense Available for shipment Available now
sa11039 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12235
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Nonsense 3 1079 1 52
Genomic Location:
Chromosome 15 (position 163469)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGANTTTTCTTTGAATCTGTTGCTACATATCTCTCTGGCTGTAGGTGGATA[T/A]GGGGGTTATGGTGGATATGGTGGTGCTGGAAGATTCTACCCAATGGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17177
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Nonsense 13 1079 1 52
Genomic Location:
Chromosome 15 (position 163497)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCTGGCTGTAGGTGGATAWGGGGGTTATGGTGGATATGGTGGTGCT[G/T]GAAGATTCTACCCAATGGCTGGAGGTCTGAAACCAGCTAAATCAGGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102316 Essential Splice Site 992 1079 46 52
Genomic Location:
Chromosome 15 (position 185411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGAGCGGGTGGTGTTGGMRGTGTTGGAGGACTSTATCCWGGAGCAG[G/A]TGAGACTTCATGCTAAACATCAGCACTTCACATATAATGTTGTGCATRGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zql4ahny