bnc2

Ensembl ID:
ENSDARG00000069989
ZFIN ID:
ZDB-GENE-030131-5784
Description:
Novel protein similar to vertebrate basonuclin 1 (BNC1) [Source:UniProtKB/TrEMBL;Acc:Q1LYS3]
Human Orthologue:
BNC2
Human Description:
basonuclin 2 [Source:HGNC Symbol;Acc:30988]
Mouse Orthologue:
Bnc2
Mouse Description:
basonuclin 2 Gene [Source:MGI Symbol;Acc:MGI:2443805]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6591 Nonsense Mutation detected in F1 DNA During 2014
sa16752 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6591
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102322 None None 172 None 2
ENSDART00000125744 Nonsense 480 1141 5 6
ENSDART00000128671 None None 252 None 5
ENSDART00000129074 Nonsense 450 966 4 9
ENSDART00000134840 None None 31 None 2

The following transcripts of ENSDARG00000069989 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 26163006)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGGCGGCCACCATTAAGTTTTGCCACCCCTCCTCTTGAGCCTATGAKA[C/T]AGTCACCTCTGCAGAGCCCACTTGTGTTCCCTTCTTTAAAGTCTGTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16752
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102322 Nonsense 101 172 1 2
ENSDART00000125744 Nonsense 870 1141 5 6
ENSDART00000128671 None None 252 None 5
ENSDART00000129074 Nonsense 718 966 7 9
ENSDART00000134840 None None 31 None 2

The following transcripts of ENSDARG00000069989 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 26164178)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGTCAAACTGCAYTACAAGAAKGTTCACCTAAAAGAGATGCATGTGTG[C/A]ACTGTCTCTGGATGCAATGCTGCTTTCCCCTCCAGGCGGAGCAGARATAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hair color: Web-based, participant-driven studies yield novel genetic associations for common traits. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Ovarian cancer: A genome-wide association study identifies a new ovarian cancer susceptibility locus on 9p22.2. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9z5vnapp