cspg5a

Ensembl ID:
ENSDARG00000069981
ZFIN ID:
ZDB-GENE-080425-4
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A5PLG4]
Human Orthologue:
CSPG5
Human Description:
chondroitin sulfate proteoglycan 5 (neuroglycan C) [Source:HGNC Symbol;Acc:2467]
Mouse Orthologue:
Cspg5
Mouse Description:
chondroitin sulfate proteoglycan 5 Gene [Source:MGI Symbol;Acc:MGI:1352747]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22925 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102305 Essential Splice Site 259 334 3 5
Genomic Location:
Chromosome 16 (position 45113020)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCCTCATGCCCGTGCTTTGGCTTACTATGATAACATTATCTGTCAGG[T/C]AACGTGTTTCTGGTCTTTCTCTCTGCTGCCCCCTCCCCTCGTCCTCCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ooc7258z