lman1

Ensembl ID:
ENSDARG00000069980
ZFIN ID:
ZDB-GENE-060201-4
Description:
Lman1 protein [Source:UniProtKB/TrEMBL;Acc:Q58EK8]
Human Orthologue:
LMAN1
Human Description:
lectin, mannose-binding, 1 [Source:HGNC Symbol;Acc:6631]
Mouse Orthologue:
Lman1
Mouse Description:
lectin, mannose-binding, 1 Gene [Source:MGI Symbol;Acc:MGI:1917611]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13208 Nonsense Available for shipment Available now
sa16718 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13208
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102304 Nonsense 417 513 11 13
ENSDART00000123476 None None 100 None 3
Genomic Location:
Chromosome 21 (position 9264341)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATGTGTTGTGCTGTGGTTTGCAGGAACTCTCTGTCAGGCTCTCTRAAG[C/T]AGCTGGCAATGGGGCAGCATCAGGGAAACGCAGGAGGATTGGGCTCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16718
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102304 Nonsense 480 513 12 13
ENSDART00000123476 None None 100 None 3
Genomic Location:
Chromosome 21 (position 9265637)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGAGAAGCTGAAGTGCCCTGAACTTCCTCCATTACCAACSTGTCTCT[C/A]GACCACACACTTCCTCATCTTYATTGTCATCCAGTCCCTCCTCTTCTTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ivg9rpof