lman1

Ensembl ID:
ENSDARG00000069980
ZFIN ID:
ZDB-GENE-060201-4
Description:
Lman1 protein [Source:UniProtKB/TrEMBL;Acc:Q58EK8]
Human Orthologue:
LMAN1
Human Description:
lectin, mannose-binding, 1 [Source:HGNC Symbol;Acc:6631]
Mouse Orthologue:
Lman1
Mouse Description:
lectin, mannose-binding, 1 Gene [Source:MGI Symbol;Acc:MGI:1917611]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37243 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43588 Nonsense Mutation detected in F1 DNA During 2016
sa13208 Nonsense Available for shipment Available now
sa16718 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37243
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102304 Essential Splice Site 126 513 2 13
ENSDART00000123476   None 100 None 3
Genomic Location (Zv9):
Chromosome 21 (position 9238722)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 10610775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGCATTTCGTGTTTCCGGACGAGGACGAATGGGAGCAGATGGATTGG[T/A]AAGTAAGAGGAGTATAGCTATTAAATATTTATTTAATAATTGATTTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43588
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102304 Nonsense 198 513 5 13
ENSDART00000123476   None 100 None 3
Genomic Location (Zv9):
Chromosome 21 (position 9246907)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 10618960
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCAGTGATGGCACGACCCAGGCACTAGGCACATGTCTTAGAGACTTC[A/T]GAAACAAACCTTACCCTATACGCACCAAAATCACTTATTACAAGCAGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13208
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102304 Nonsense 417 513 11 13
ENSDART00000123476   None 100 None 3
Genomic Location (Zv9):
Chromosome 21 (position 9264341)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 10636394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATGTGTTGTGCTGTGGTTTGCAGGAACTCTCTGTCAGGCTCTCTRAAG[C/T]AGCTGGCAATGGGGCAGCATCAGGGAAACGCAGGAGGATTGGGCTCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16718
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102304 Nonsense 480 513 12 13
ENSDART00000123476   None 100 None 3
Genomic Location (Zv9):
Chromosome 21 (position 9265637)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 10637690
KASP Assay ID:
2261-5274.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGAGAAGCTGAAGTGCCCTGAACTTCCTCCATTACCAACSTGTCTCT[C/A]GACCACACACTTCCTCATCTTYATTGTCATCCAGTCCCTCCTCTTCTTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link