csrp3

Ensembl ID:
ENSDARG00000069975
ZFIN IDs:
ZDB-GENE-041010-119, ZDB-GENE-041010-119
Description:
cysteine and glycine-rich protein 3 (cardiac LIM protein) [Source:RefSeq peptide;Acc:NP_001006026]
Human Orthologue:
CSRP3
Human Description:
cysteine and glycine-rich protein 3 (cardiac LIM protein) [Source:HGNC Symbol;Acc:2472]
Mouse Orthologue:
Csrp3
Mouse Description:
cysteine and glycine-rich protein 3 Gene [Source:MGI Symbol;Acc:MGI:1330824]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8262 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8262
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053404 Essential Splice Site 38 193 None 5
ENSDART00000102292 Essential Splice Site 38 193 None 7
Genomic Location:
Chromosome 7 (position 17333779)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATCCAGTGCAACAGCCGCAGCTTCCATAAAACATGCTTCATCTGCAG[T/C]AAGACAACAAAGCATTCACAAGAKGATTAAATGTSATATTTACYATGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hy293dtu