lingo2

Ensembl ID:
ENSDARG00000069970
ZFIN ID:
ZDB-GENE-080723-57
Description:
leucine rich repeat and Ig domain containing 2-like [Source:RefSeq peptide;Acc:NP_001139054]
Human Orthologue:
LINGO2
Human Description:
leucine rich repeat and Ig domain containing 2 [Source:HGNC Symbol;Acc:21207]
Mouse Orthologue:
Lingo2
Mouse Description:
leucine rich repeat and Ig domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2442298]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9317 Nonsense Mutation detected in F1 DNA During 2014
sa9260 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9317
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102279 Nonsense 508 607 1 1
ENSDART00000102279 Nonsense 508 607 1 1
Genomic Location:
Chromosome 13 (position 12609987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCYGTAACACTCGCRGTTAAAACCTCTGGAATCAGGGACAGGGCCCTTTA[C/A]GCGAACCGCAGCTTTCTTTTTGACCCCGACTACAATAGTTCCCTGATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102279 Nonsense 508 607 1 1
ENSDART00000102279 Nonsense 508 607 1 1
Genomic Location:
Chromosome 13 (position 12609987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCYGTAACACTCGCRGTTAAAACCTCTGGAATCAGGGACAGGGCCCTTTA[C/A]GCGAACCGCAGCTTTCTTTTTGACCCCGACTACAATAGTTCCCTGATAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b3g838gx