lingo2

Ensembl ID:
ENSDARG00000069970
ZFIN ID:
ZDB-GENE-080723-57
Description:
leucine rich repeat and Ig domain containing 2-like [Source:RefSeq peptide;Acc:NP_001139054]
Human Orthologue:
LINGO2
Human Description:
leucine rich repeat and Ig domain containing 2 [Source:HGNC Symbol;Acc:21207]
Mouse Orthologue:
Lingo2
Mouse Description:
leucine rich repeat and Ig domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2442298]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9317 Nonsense Mutation detected in F1 DNA During 2016
sa9260 Nonsense Mutation detected in F1 DNA During 2016
sa35437 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9317
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102279 Nonsense 508 607 1 1
ENSDART00000102279 Nonsense 508 607 1 1
Genomic Location:
Chromosome 13 (position 12609987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCYGTAACACTCGCRGTTAAAACCTCTGGAATCAGGGACAGGGCCCTTTA[C/A]GCGAACCGCAGCTTTCTTTTTGACCCCGACTACAATAGTTCCCTGATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102279 Nonsense 508 607 1 1
ENSDART00000102279 Nonsense 508 607 1 1
Genomic Location:
Chromosome 13 (position 12609987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCYGTAACACTCGCRGTTAAAACCTCTGGAATCAGGGACAGGGCCCTTTA[C/A]GCGAACCGCAGCTTTCTTTTTGACCCCGACTACAATAGTTCCCTGATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102279 Nonsense 601 607 1 1
Genomic Location:
Chromosome 13 (position 12610264)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAGAGGAAAGGCGCAAACTCAGAACTTACAGAAACAAGCGGGCCAAGA[C/T]GAGTCAACATGAAGATGATCTGAACTTTGTGAATGACAGAGGATTTCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link