il21r

Ensembl ID:
ENSDARG00000069961
ZFIN ID:
ZDB-GENE-080108-6
Description:
interleukin-21 receptor [Source:RefSeq peptide;Acc:NP_001106982]
Human Orthologue:
IL21R
Human Description:
interleukin 21 receptor [Source:HGNC Symbol;Acc:6006]
Mouse Orthologue:
Il21r
Mouse Description:
interleukin 21 receptor Gene [Source:MGI Symbol;Acc:MGI:1890475]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33294 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33294
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102243 Essential Splice Site 19 508 1 7
Genomic Location (Zv9):
Chromosome 3 (position 45398450)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47408003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATGGCGAGCCACATTCTTGCTTGTTGTTTGTGGACTTCTACAGTGCT[G/T]TAAGTCTACATCTATTGCAGCACATTTGGTTTCTAAAAAATCAAAGCATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: IL21R and PTH may underlie variation of femoral neck bone mineral density as revealed by a genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link