Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
il21r
- Ensembl ID:
- ENSDARG00000069961
- ZFIN ID:
- ZDB-GENE-080108-6
- Description:
- interleukin-21 receptor [Source:RefSeq peptide;Acc:NP_001106982]
- Human Orthologue:
- IL21R
- Human Description:
- interleukin 21 receptor [Source:HGNC Symbol;Acc:6006]
- Mouse Orthologue:
- Il21r
- Mouse Description:
- interleukin 21 receptor Gene [Source:MGI Symbol;Acc:MGI:1890475]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa33294 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa33294
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000102243 | Essential Splice Site | 19 | 508 | 1 | 7 |
- Genomic Location (Zv9):
- Chromosome 3 (position 45398450)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 47408003 GRCz11 3 45360337 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCATGGCGAGCCACATTCTTGCTTGTTGTTTGTGGACTTCTACAGTGCT[G/T]TAAGTCTACATCTATTGCAGCACATTTGGTTTCTAAAAAATCAAAGCATA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bone mineral density: IL21R and PTH may underlie variation of femoral neck bone mineral density as revealed by a genome-wide association study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
