itga6b

Ensembl ID:
ENSDARG00000069946
ZFIN ID:
ZDB-GENE-050320-5
Description:
integrin, alpha 6b [Source:RefSeq peptide;Acc:NP_001013466]
Human Orthologue:
ITGA6
Human Description:
integrin, alpha 6 [Source:HGNC Symbol;Acc:6142]
Mouse Orthologue:
Itga6
Mouse Description:
integrin alpha 6 Gene [Source:MGI Symbol;Acc:MGI:96605]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3354 Nonsense Mutation detected in F1 DNA During 2014
sa16239 Nonsense Available for shipment Available now
sa10618 Nonsense Available for shipment Available now
sa1967 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa3354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102210 Nonsense 152 1085 4 25
Genomic Location:
Chromosome 1 (position 30092847)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTTATTTGTTGGCTCAGTTCAGGAACTGCGTGACTTGACAGGTCGKTG[C/A]TATGTACTTAGTGAGGATGTGACGATTAATGAGATCTCAGATGAAGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16239
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102210 Nonsense 202 1085 4 25
Genomic Location:
Chromosome 1 (position 30092997)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATCATGCCAGCAGGGCATGTCCGCCACRTTCACAAAGGACTATCACTA[T/G]CTGGTGTTTGGAGCACCAGGCGCTTACAACTGGAAAGGTATTAAAGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10618
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102210 Nonsense 418 1085 8 25
Genomic Location:
Chromosome 1 (position 30098702)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATATGACAGCAATGGAGCTGGAAACRTGATTATCTTCCACGGTTCACCA[C/T]AAGGACTGAAAAAATCCCAGGTGCAGCCATATATCCACTTTACTTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1967
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102210 Nonsense 772 1085 18 25
Genomic Location:
Chromosome 1 (position 30110974)
KASP Assay ID:
554-2453.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAAAAAATGTATRTGACTTGAAGTGTTGTAATTTGCAGGACAAGTGAA[C/T]AGAAGCAATTGCAAGCAGTCAAAGCCAAAGCCATTGTTAAGATCCAGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a8wnykhf