B0UXG7_DANRE

Ensembl ID:
ENSDARG00000069942
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0UXG7]
Human Orthologue:
NDUFV3
Human Description:
NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa [Source:HGNC Symbol;Acc:7719]
Mouse Orthologue:
Ndufv3
Mouse Description:
NADH dehydrogenase (ubiquinone) flavoprotein 3 Gene [Source:MGI Symbol;Acc:MGI:1890894]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1611 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1611
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102213 None None 107 None 3
ENSDART00000139282 Essential Splice Site 457 514 3 4
Genomic Location:
Chromosome 9 (position 20561152)
KASP Assay ID:
554-1552.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGCTGTCGAGGCACTGGCTCAGACAGATGTTGTGGAAACACCTGAGG[G/A]TACACCACACTTCTTCACTCAGTTTCTTTCTCTGGATTTGTCACATCACA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5v0eb6e5