dnm2

Ensembl ID:
ENSDARG00000069937
ZFIN ID:
ZDB-GENE-050913-84
Description:
dynamin-1 [Source:RefSeq peptide;Acc:NP_001025299]
Human Orthologue:
DNM2
Human Description:
dynamin 2 [Source:HGNC Symbol;Acc:2974]
Mouse Orthologue:
Dnm2
Mouse Description:
dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20128 Nonsense Available for shipment Available now
sa20129 Essential Splice Site Available for shipment Available now
sa13248 Nonsense Available for shipment Available now
sa13768 Nonsense Available for shipment Available now
sa17720 Essential Splice Site Available for shipment Available now
sa9093 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16501 Essential Splice Site Available for shipment Available now
sa20130 Nonsense Available for shipment Available now
sa15133 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20128
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 Nonsense 25 755 1 18
ENSDART00000097146 Nonsense 25 872 1 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48319404)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50320544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTGATCCCCCTGATCAATAAACTCCAAGATGCTTTCAGCTCCATTGGC[C/T]AAAGTTGTAACCTGGATCTGCCGCAGATAGCAGTTGTCGGAGGACAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20129
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 Essential Splice Site 129 755 3 18
ENSDART00000097146 Essential Splice Site 129 872 3 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48352601)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50353741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGGCATCTCTCCTATCCCCATCAACCTGAGAGTCTACTCTCCTAACGG[T/C]AATGCAAAACTAGACCCTGGAGGAGCGCAGTTTCCCGCAGTCAGTCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13248
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 Nonsense 130 755 4 18
ENSDART00000097146 Nonsense 130 872 4 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48352694)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50353834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCTGCTATTGGTRAAAWGTCACTCTCCTCTGTCTTTGATCAMCAGTAT[T/A]GAATCTGACACTCATCGATTTGCCTGGGAYGACGAAGGTGGCAGTGGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13768
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 Nonsense 265 755 6 18
ENSDART00000097146 Nonsense 265 872 6 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48355835)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50356975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGCTGCGMTGGCAGCAGAAAGGAAGTDTTTCCTGTCCCACCCTAGTTA[C/A]AGACATATGGCTGAAAGGATGGGAACGCCACACCTGCAAAAAGCCCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17720
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 Essential Splice Site 331 755 8 18
ENSDART00000097146 Essential Splice Site 331 872 8 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48358454)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50359594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYGCTCGTAACTAATTCTAGCAGTTTCTAACTCTGAGTTCTGCTTTTTTA[G/T]RATGGTCCAGCAATTTGGTGTGGACTTTGAGAAGTGCATTGAGGGRTCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 Essential Splice Site 498 755 None 18
ENSDART00000097146 Essential Splice Site 498 872 None 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48368301)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50369441
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGTCATACATCAACACCAACCACGAGGACTTCATTGGATTTGCAAAG[T/A]ATGYGTTGCATTCAGTGCAGTCATTTTTTTTTTTTTTTGGCNTTTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16501
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031   None 755 None 18
ENSDART00000097146 Essential Splice Site 518 872 14 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48373125)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50374265
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACCCCCTTCCCCCTCCCTCTTACTTATCACTACAGGGTGAAATCCTGG[T/A]AAGTACCATAAACTTACAAGYCACACCCAGTTAAAGGTCACCAGTGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20130
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 Nonsense 594 755 16 18
ENSDART00000097146 Nonsense 598 872 17 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48386994)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50388134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGTGGCTTCATGTGTTCGATCCCCCTCGCAGGAATGTGTATAAGGACT[T/A]GCGTCAGATCGAGCTGGCCTGTGACTCGCAGGAGGACATGGATAGTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15133
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024031 Nonsense 648 755 17 18
ENSDART00000097146 Nonsense 656 872 18 22

The following transcripts of ENSDARG00000069937 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 48389670)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50390810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCCCAGCCGACAGCTTCTCCATGGACCCTCAGTTGGAAAGACAGGTC[G/T]AGACCATCCGTAACCTGGTGGACTCCTATATTGGAATCRTCAACAAAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coronary heart disease: Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link