si:dkey-174k18.1

Ensembl ID:
ENSDARG00000069934
ZFIN ID:
ZDB-GENE-070912-387
Description:
LOC558045 protein [Source:UniProtKB/TrEMBL;Acc:Q08CM6]
Human Orthologue:
PARP4
Human Description:
poly (ADP-ribose) polymerase family, member 4 [Source:HGNC Symbol;Acc:271]
Mouse Orthologue:
Parp4
Mouse Description:
poly (ADP-ribose) polymerase family, member 4 Gene [Source:MGI Symbol;Acc:MGI:2685589]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31709 Nonsense Available for shipment Available now
sa21460 Essential Splice Site Available for shipment Available now
sa11154 Nonsense Available for shipment Available now
sa10640 Nonsense Available for shipment Available now
sa34608 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31709
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038257 Nonsense 651 1795 15 33
ENSDART00000052754   None 281 None 7
ENSDART00000133865 Nonsense 38 156 2 4
ENSDART00000143478   None 369 None 8
ENSDART00000145111   None 278 None 4
ENSDART00000145320   None 107 None 2
ENSDART00000148056   None 404 None 10
Genomic Location (Zv9):
Chromosome 9 (position 21526631)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 20682417
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTTCTCTGCTCTGTCACTAGGTCATCATTTTTCAGACCTACACAAAT[C/T]AGAGTGCTGTTCCCATTGAAGCAAAGTTTGTCTTTCCACTGGAGGAGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21460
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038257 Essential Splice Site 686 1795 16 33
ENSDART00000052754   None 281 None 7
ENSDART00000133865 Essential Splice Site 73 156 3 4
ENSDART00000143478   None 369 None 8
ENSDART00000145111   None 278 None 4
ENSDART00000145320   None 107 None 2
ENSDART00000148056   None 404 None 10
Genomic Location (Zv9):
Chromosome 9 (position 21526820)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 20682606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTTAAAGCTATTTTCTGTTCATTTTACAAGTGTTTCTTTGTGCTGTA[G/A]GTAAAGGAAAAAGAGCAGGCTCGTAAGGAGTACAAGCAGGCTATAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11154
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038257 Nonsense 959 1795 23 33
ENSDART00000052754   None 281 None 7
ENSDART00000133865   None 156 None 4
ENSDART00000143478   None 369 None 8
ENSDART00000145111   None 278 None 4
ENSDART00000145320   None 107 None 2
ENSDART00000148056 Nonsense 151 404 4 10
Genomic Location (Zv9):
Chromosome 9 (position 21529617)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 20685403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTCCTGTCTTCAGTCRTGTAGCGGCGCTGGTGGCAGCACTGATCTGT[G/A]GCGKCCTCTCCGGAGYCTTAGCYTGCTGCCCCCCTGCCAGGGCATGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10640
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038257 Nonsense 1023 1795 24 33
ENSDART00000052754   None 281 None 7
ENSDART00000133865   None 156 None 4
ENSDART00000143478   None 369 None 8
ENSDART00000145111   None 278 None 4
ENSDART00000145320   None 107 None 2
ENSDART00000148056 Nonsense 215 404 5 10
Genomic Location (Zv9):
Chromosome 9 (position 21529897)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 20685683
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTTTGTCTAGCTTGACCGCTAATCGTCATATGCTCAGAGCTTTGGCT[C/T]AGGCAGGYGGAGGAACATATGAGTTTTTTGACACAAAGATGAAAYACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34608
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038257 Essential Splice Site 1688 1795 31 33
ENSDART00000052754   None 281 None 7
ENSDART00000133865   None 156 None 4
ENSDART00000143478   None 369 None 8
ENSDART00000145111 Essential Splice Site 171 278 2 4
ENSDART00000145320   None 107 None 2
ENSDART00000148056   None 404 None 10
Genomic Location (Zv9):
Chromosome 9 (position 21533314)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 20689100
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTTTTTGCCAACATTTTCCTTAAGGAGAAAGGCATCCAATCTTTAGG[T/C]AACATATCTTTTACTGCCTGTTGCTGCTTTGTTTTTGACTGTCTACTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link