PLEKHG4B (2 of 2)

Ensembl ID:
ENSDARG00000069929
Description:
pleckstrin homology domain containing, family G (with RhoGef domain) member 4B [Source:HGNC Symbol;A
Human Orthologue:
PLEKHG4B
Human Description:
pleckstrin homology domain containing, family G (with RhoGef domain) member 4B [Source:HGNC Symbol;A

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36268 Nonsense Mutation detected in F1 DNA During 2017
sa36269 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36270 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36268
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102170 Nonsense 79 712 2 15
Genomic Location (Zv9):
Chromosome 16 (position 56679200)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53261956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTGTTGGCTTGTGACAGCTGCGATTTAAAGGTGTGTTGCTGTACCAC[G/T]AGGGATGGCCGCTGTGTCTGCATGAGAAGGTGGTTCTGCAACTGGCGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102170 Essential Splice Site 562 712 11 15
Genomic Location (Zv9):
Chromosome 16 (position 56717761)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53300517
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTATTTATTGCTTTTTAAGTCATGCCTTGTGAATTCTTCTGTCCCTCC[A/T]GGCTTCTGTACCCAATGCACTTTACTCAGTTTTGTTTCTGGTGGAAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36270
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102170 Nonsense 702 712 15 15
Genomic Location (Zv9):
Chromosome 16 (position 56720738)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53303494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGAACCGGCTGCGGCTGGAGGGAGGAACATTTCTGGCCCGGCTCAGG[A/T]AAGAGGAGATGTGTGAAAACCACAACTACAGGTGCTCACTTAGACATTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link