prkceb

Ensembl ID:
ENSDARG00000069928
ZFIN ID:
ZDB-GENE-081028-47
Description:
Novel protein similar to vertebrate protein kinase C, epsilon (PRKCE) [Source:UniProtKB/TrEMBL;Acc:B
Human Orthologue:
PRKCE
Human Description:
protein kinase C, epsilon [Source:HGNC Symbol;Acc:9401]
Mouse Orthologue:
Prkce
Mouse Description:
protein kinase C, epsilon Gene [Source:MGI Symbol;Acc:MGI:97599]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11044 Nonsense Available for shipment Available now
sa31906 Essential Splice Site Available for shipment Available now
sa22222 Nonsense Available for shipment Available now
sa35422 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11044
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045086 Nonsense 180 738 3 15
Genomic Location (Zv9):
Chromosome 13 (position 7892626)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8197146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGAGTACATCAAGTCAACGGACACAAGTTCATGGCCACCTACCTGAGA[C/T]AGCCCACCTACTGCTCACACTGCCGCGAYTTCATCTGGTGAGAWATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31906
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045086 Essential Splice Site 204 738 4 15
Genomic Location (Zv9):
Chromosome 13 (position 7889863)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8194383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCATTTCACAGGGGTGTATTAGGAAAGCAAGGTTATCAGTGTCAAGG[T/A]AAGTGAACAACATAAAATGTGCCTATATTAGAGTTTCATGTTTTCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22222
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045086 Nonsense 213 738 5 15
Genomic Location (Zv9):
Chromosome 13 (position 7886510)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8191030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCCTTTTCTCTGACTTTCAGTGTGCACCTGTGTAGTTCATAAACGCTG[C/A]CATGAACTGATCATCACTAAATGTGCAGGTTTGAAGAAACAGGAGGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045086 Nonsense 472 738 10 15
Genomic Location (Zv9):
Chromosome 13 (position 7878052)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8182572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTGAAAAACGCATTCTAGCCCTGGCCAGGAAACATCCCTATCTTACA[C/T]AACTCTACTGCTGCTTTCAGACTAAGGTAAGAGCCAGGACTATTTGTCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link