ENSDARG00000069904

Ensembl ID:
ENSDARG00000069904
Human Orthologues:
COL19A1, COL21A1, COL9A1, COL9A2, COL9A3
Human Descriptions:
collagen, type IX, alpha 1 [Source:HGNC Symbol;Acc:2217]
collagen, type IX, alpha 2 [Source:HGNC Symbol;Acc:2218]
collagen, type IX, alpha 3 [Source:HGNC Symbol;Acc:2219]
collagen, type XIX, alpha 1 [Source:HGNC Symbol;Acc:2196]
collagen, type XXI, alpha 1 [Source:HGNC Symbol;Acc:17025]
Mouse Orthologues:
Col19a1, Col9a1, Col9a2, Col9a3
Mouse Descriptions:
collagen, type IX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88465]
collagen, type IX, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:88466]
collagen, type IX, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:894686]
collagen, type XIX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1095415]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24419 Nonsense Mutation detected in F1 DNA During 2016
sa25200 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030004 Nonsense 293 606 1 14
Genomic Location (Zv9):
Chromosome 23 (position 46278089)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 46163556
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCAGGCAAGAGTCTCGATGCTGAAAACGAGACCGAGGATCATCATCTT[A/T]AGAAGCCGAGAGGGACTCGATCCACCCCAGATCTGATCTCCATCATCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25200
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030004 Nonsense 466 606 6 14
Genomic Location (Zv9):
Chromosome 23 (position 46233562)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 46119029
KASP Assay ID:
554-7890.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGATCATAATCCGCATCTGTTTTCCTCCATTGTAGGGTCCCAAAGGCTA[T/A]CCAGGACCCGCAGGTCTGCCCGGAGAACAGGTGAGTTGATGAAACGCACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link