ENSDARG00000069904

Ensembl ID:
ENSDARG00000069904
Human Orthologues:
COL19A1, COL21A1, COL9A1, COL9A2, COL9A3
Human Descriptions:
collagen, type IX, alpha 1 [Source:HGNC Symbol;Acc:2217]
collagen, type IX, alpha 2 [Source:HGNC Symbol;Acc:2218]
collagen, type IX, alpha 3 [Source:HGNC Symbol;Acc:2219]
collagen, type XIX, alpha 1 [Source:HGNC Symbol;Acc:2196]
collagen, type XXI, alpha 1 [Source:HGNC Symbol;Acc:17025]
Mouse Orthologues:
Col19a1, Col9a1, Col9a2, Col9a3
Mouse Descriptions:
collagen, type IX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88465]
collagen, type IX, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:88466]
collagen, type IX, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:894686]
collagen, type XIX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1095415]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5067 Nonsense Mutation detected in F1 DNA During 2014
sa24419 Nonsense Mutation detected in F1 DNA During 2014
sa25200 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030004 Nonsense 199 606 1 14
Genomic Location:
Chromosome 23 (position 46278369)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTGGACATCTACCCATCWGCCCAGGCTGCGGCACACTACTGCCAGTA[T/A]CTTAAAAAACAGTGCAGACTGTCGGACACCTTCCGATCTCAGTCCCCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030004 Nonsense 293 606 1 14
Genomic Location:
Chromosome 23 (position 46278089)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCAGGCAAGAGTCTCGATGCTGAAAACGAGACCGAGGATCATCATCTT[A/T]AGAAGCCGAGAGGGACTCGATCCACCCCAGATCTGATCTCCATCATCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25200
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030004 Nonsense 466 606 6 14
Genomic Location:
Chromosome 23 (position 46233562)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGATCATAATCCGCATCTGTTTTCCTCCATTGTAGGGTCCCAAAGGCTA[T/A]CCAGGACCCGCAGGTCTGCCCGGAGAACAGGTGAGTTGATGAAACGCACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/smvzc12e