GIMAP8 (108 of 111)

Ensembl ID:
ENSDARG00000069895
Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Human Orthologue:
GIMAP8
Human Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Mouse Orthologue:
Gimap8
Mouse Description:
GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7480 Missense Mutation detected in F1 DNA During 2017
sa44963 Nonsense Mutation detected in F1 DNA During 2017
sa1184 Nonsense Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa7480
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102099 Missense 5 255 1 3
Genomic Location (Zv9):
Chromosome 21 (position 12711980)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14413154
KASP Assay ID:
554-4046.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGCAGTTATTAATTCAAATGTGATTWCTTTCAGGTAAGGACCAACAA[C/T]TCACTGATATACAGATTGTAATGCTTGGAGCATCATGGGCTGCAAAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102099 Nonsense 137 255 3 3
Genomic Location (Zv9):
Chromosome 21 (position 12714202)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGAGAGCATCTCTGGAAACATACTCTGATTATATTCTCCGGATCTTG[G/A]CTGAAGGACAGACCAGTTGAACAGTATATTGCGTGTGAAGGAGAAGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1184
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102099 Nonsense 141 255 3 3
Genomic Location (Zv9):
Chromosome 21 (position 12714212)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14415386
KASP Assay ID:
554-1094.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCTGGAAACATACTCTGATTATATTCTCCGGATCTTGGCTGAAGGAC[A/T]GACCAGTTGAACRGTATATTGCGTGTGAAGGAGAAGCCCTGCAGAGCTTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link