GIMAP8 (108 of 111)

Ensembl ID:
ENSDARG00000069895
Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Human Orthologue:
GIMAP8
Human Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Mouse Orthologue:
Gimap8
Mouse Description:
GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7480 Missense Mutation detected in F1 DNA During 2017
sa1184 Nonsense Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa7480
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102099 Missense 5 255 1 3
Genomic Location (Zv9):
Chromosome 21 (position 12711980)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14413154
KASP Assay ID:
554-4046.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGCAGTTATTAATTCAAATGTGATTWCTTTCAGGTAAGGACCAACAA[C/T]TCACTGATATACAGATTGTAATGCTTGGAGCATCATGGGCTGCAAAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1184
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102099 Nonsense 141 255 3 3
Genomic Location (Zv9):
Chromosome 21 (position 12714212)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14415386
KASP Assay ID:
554-1094.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCTGGAAACATACTCTGATTATATTCTCCGGATCTTGGCTGAAGGAC[A/T]GACCAGTTGAACRGTATATTGCGTGTGAAGGAGAAGCCCTGCAGAGCTTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link