coq3

Ensembl ID:
ENSDARG00000069857
ZFIN ID:
ZDB-GENE-040718-364
Description:
hexaprenyldihydroxybenzoate methyltransferase, mitochondrial [Source:RefSeq peptide;Acc:NP_00100262
Human Orthologue:
COQ3
Human Description:
coenzyme Q3 homolog, methyltransferase (S. cerevisiae) [Source:HGNC Symbol;Acc:18175]
Mouse Orthologue:
Coq3
Mouse Description:
coenzyme Q3 homolog, methyltransferase (yeast) Gene [Source:MGI Symbol;Acc:MGI:101813]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22890 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034109 Nonsense 109 319 3 6

The following transcripts of ENSDARG00000069857 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 34974144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCCTTAATCTAATTTTGTGACCTTTGACCTTATTTTCAGGGATAATT[T/A]GTTGAACGTGCATGGAGTCCGGCAGTTGGGTAAACCTCTGAGTGGCCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rxgf3gxs