sfrs18

Ensembl ID:
ENSDARG00000069855
ZFIN ID:
ZDB-GENE-030131-362
Description:
splicing factor, arginine/serine-rich 18 [Source:RefSeq peptide;Acc:NP_001077306]
Human Orthologue:
SFRS18
Human Description:
splicing factor, arginine/serine-rich 18 [Source:HGNC Symbol;Acc:21222]
Mouse Orthologue:
Sfrs18
Mouse Description:
serine/arginine-rich splicing factor 18 Gene [Source:MGI Symbol;Acc:MGI:1913875]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25023 Nonsense Mutation detected in F1 DNA During 2017
sa28694 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101994 Nonsense 42 822 3 12
ENSDART00000123980 Nonsense 32 803 2 10
ENSDART00000124515 Nonsense 32 812 4 13

The following transcripts of ENSDARG00000069855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 34986040)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32717540
KASP Assay ID:
554-7872.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGAACTGCTCAATTCAGTGCACGTTTTCTCGGTTTGTTTTCGCAGGT[C/T]AAGTGGACTGGGCTGCTTTAGCACAAGCATGGATTGCACAGAAGGAATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101994 Nonsense 116 822 4 12
ENSDART00000123980 Nonsense 106 803 3 10
ENSDART00000124515 Nonsense 106 812 5 13

The following transcripts of ENSDARG00000069855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 34985462)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32716962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTAGAGTGGGGAATGCATAGCCAGCCACCACCTCCCCCTCCTCCAGAA[C/T]AAGCATGGATTCCTTCAGGTCAAGGGCCAATGGATGTTGTCAACCCCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link