ENSDARG00000069839

Ensembl ID:
ENSDARG00000069839
Mouse Orthologues:
Tcrb-C1, Tcrb-C2
Mouse Descriptions:
T-cell receptor beta, constant region 1 Gene [Source:MGI Symbol;Acc:MGI:4439726]
T-cell receptor beta, constant region 2 Gene [Source:MGI Symbol;Acc:MGI:4835227]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18301 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18301
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101970 Nonsense 211 237 4 4
Genomic Location:
Chromosome 3 (position 59544097)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCACAAATTCARGAGCAGCAGTTCTTTMACCATCCAGARSTCCGAGT[G/A]GGACAAAGACAGAGAGCTGACATGTGAAGCCACTGTGGCCTCCAAAACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0jzopgtv