cx55.5

Ensembl ID:
ENSDARG00000069830
ZFIN ID:
ZDB-GENE-010619-3
Description:
gap junction alpha-9 protein [Source:RefSeq peptide;Acc:NP_571887]
Human Orthologues:
GJA10, GJA9
Human Descriptions:
gap junction protein, alpha 10, 62kDa [Source:HGNC Symbol;Acc:16995]
gap junction protein, alpha 9, 59kDa [Source:HGNC Symbol;Acc:19155]
Mouse Orthologue:
Gja10
Mouse Description:
gap junction protein, alpha 10 Gene [Source:MGI Symbol;Acc:MGI:1339969]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22892 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101948 Nonsense 49 498 1 1
Genomic Location:
Chromosome 16 (position 35471858)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGCATGCTGGTGCTTGGTGTGGCAGCGGAGGATGTGTGGAATGATGAA[C/T]AGGCTGACTTTATCTGCAACACCGAGCAGCCTGGTTGCCGCAATGTGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j73cu15p