LOC100149324

Ensembl ID:
ENSDARG00000069823
Human Orthologue:
PROCA1
Human Description:
protein interacting with cyclin A1 [Source:HGNC Symbol;Acc:28600]
Mouse Orthologue:
Proca1
Mouse Description:
protein interacting with cyclin A1 Gene [Source:MGI Symbol;Acc:MGI:1918274]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42508 Nonsense Mutation detected in F1 DNA During 2016
sa8918 Nonsense Mutation detected in F1 DNA During 2016
sa35829 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42508
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101918 Nonsense 430 729 4 4
Genomic Location (Zv9):
Chromosome 15 (position 14465849)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15510812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCATGGGTAAGAACAACTACATGGAGGAAACACCAAACACAAATCAAT[T/G]AAGCGTAAAAGAAAACAATTTCATGAACAGCGAGCTAGACGCAGTAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101918 Nonsense 627 729 4 4
Genomic Location (Zv9):
Chromosome 15 (position 14465258)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15510221
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCTCTSAAGASCCTCTATTGTCCACAAGCACTGTTGAACCGACTGACT[T/A]GCAAGAGAGACTGGGATTGGACAATCTTGAARATGCACAACAGAGTTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101918 Nonsense 675 729 4 4
Genomic Location (Zv9):
Chromosome 15 (position 14465115)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15510078
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCGTTTTGCCTGATGTTGCAGACACGACACCCCTGCCGACACTAATC[G/T]AAAAGGACAATGAGTTTCAGTTAAAGGACCCGGAGGTACATACAGTGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link