GPN2_DANRE

Ensembl ID:
ENSDARG00000069820
Description:
GPN-loop GTPase 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6PUR6]
Human Orthologue:
GPN2
Human Description:
GPN-loop GTPase 2 [Source:HGNC Symbol;Acc:25513]
Mouse Orthologue:
Gpn2
Mouse Description:
GPN-loop GTPase 2 Gene [Source:MGI Symbol;Acc:MGI:2140368]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36201 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101912 Nonsense 131 311 2 6
Genomic Location (Zv9):
Chromosome 16 (position 36247946)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33986192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAAGTGGAACTGTACACTCATCACAATTCAGTGAAGAATATCTTTGCA[C/T]AGCTGTCCAAGTGGAATTTCAGGGTACGTTCTTTTCTCTTTTGTATTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link