si:ch73-257c13.3

Ensembl ID:
ENSDARG00000069808
ZFIN ID:
ZDB-GENE-081104-270
Description:
Novel protein similar to vertebrate osteopetrosis associated transmembrane protein 1 (OSTM1) [Source
Human Orthologue:
OSTM1
Human Description:
osteopetrosis associated transmembrane protein 1 [Source:HGNC Symbol;Acc:21652]
Mouse Orthologue:
Ostm1
Mouse Description:
osteopetrosis associated transmembrane protein 1 Gene [Source:MGI Symbol;Acc:MGI:2655574]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14055 Nonsense Available for shipment Available now
sa37077 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14055
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101887 Nonsense 90 329 1 6
ENSDART00000145269 Nonsense 72 311 1 6
Genomic Location (Zv9):
Chromosome 20 (position 32517251)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32575491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATCAAAGGCGAACAGTTTRGAGTTTTTCTACTCTCTCAGCCTTTCAT[C/A]ATTTCCAGAGGACTTGGAAGTGAACGAGTATTGTATTGAACTGCTTCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101887 Nonsense 129 329 1 6
ENSDART00000145269 Nonsense 111 311 1 6
Genomic Location (Zv9):
Chromosome 20 (position 32517369)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32575609
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGACTTTCGCTAACTGTCTTGTGTTTTATGCACGACCTGTCAAAGTCTG[T/A]CAGAACTGTTACACTGGCTTTAAAGGTCTGAAGGAGATATATCTAAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link