NM_001077563.1

Ensembl ID:
ENSDARG00000069807
Description:
zinc finger, DHHC-type containing 18 (zdhhc18), mRNA [Source:RefSeq DNA;Acc:NM_001077563]
Human Orthologue:
PIGV
Human Description:
phosphatidylinositol glycan anchor biosynthesis, class V [Source:HGNC Symbol;Acc:26031]
Mouse Orthologue:
Pigv
Mouse Description:
phosphatidylinositol glycan anchor biosynthesis, class V Gene [Source:MGI Symbol;Acc:MGI:2442480]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22895 Nonsense Available for shipment Available now
sa36202 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13974 Essential Splice Site Available for shipment Available now
sa6440 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22895
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130540 Nonsense 296 523 2 12
Genomic Location (Zv9):
Chromosome 16 (position 36405972)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34035755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTCTTTCAGTTTTATGGCTTTCAAACATTTTGCCATCCAACTTCAAAC[C/T]AAATTCCTCCTGCGCTGGTTAATTTAGCTCAGCACAAAGGATATCGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36202
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130540 Essential Splice Site None 523 3 12
Genomic Location (Zv9):
Chromosome 16 (position 36408608)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34038391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCGCTTTCTTCAGGTAATAATCATCGGCTAGGGAAGTGAACGCTGAG[G/A]TAAATGTTGCTCTTCATTGGTAGATGTACGCTCGCTTTCTTTAGCATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13974
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130540 Essential Splice Site None 523 None 12
Genomic Location (Zv9):
Chromosome 16 (position 36408609)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34038392
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCGCTTTCTTCAGGTAATAATCATCRGCTAGGGAAGTGAACRCTGAGG[T/A]AAAYGTTGCTCWTCATTGGTAGATGTACGCTCGCTTTCTTTAGCATTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6440
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130540 Essential Splice Site None 523 None 12

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 36411992)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34041775
KASP Assay ID:
554-5125.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTGACTTCCTTTATCTTTGGCTGTGTGATCACTCACCTCACTTTGCG[T/C]AAGTTTCAACAGTCACTTTTATACAAWTATAATGTGCCTGCATATRTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link