LOC560530

Ensembl ID:
ENSDARG00000069806
Human Orthologue:
SSTR2
Human Description:
somatostatin receptor 2 [Source:HGNC Symbol;Acc:11331]
Mouse Orthologue:
Sstr2
Mouse Description:
somatostatin receptor 2 Gene [Source:MGI Symbol;Acc:MGI:98328]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16611 Nonsense Available for shipment Available now
sa11762 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16611
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101888 Nonsense 71 373 1 1
Genomic Location:
Chromosome 3 (position 63079730)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTCCTGGTGTGTGTGGTCGGGCTGTGCRGAAACGCTCTGGKTATTTA[C/A]GTGATCCTGCGCTACGCTAAGATGAAGACGGTCACCAATATCTACATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11762
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101888 Nonsense 232 373 1 1
Genomic Location:
Chromosome 3 (position 63079247)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTTCCTCCTGGGGTTCTTCCTCCCGCTGWTGGTCATCTGCCTGTGCTA[T/A]CTGCTGATCAWCATYAAGGTCAAGTCCTCGGGGATCAASGTGAGCTCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8udiz52r