LOC100004739

Ensembl ID:
ENSDARG00000069800
Human Orthologue:
CYSLTR2
Human Description:
cysteinyl leukotriene receptor 2 [Source:HGNC Symbol;Acc:18274]
Mouse Orthologue:
Cysltr2
Mouse Description:
cysteinyl leukotriene receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1917336]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23934 Nonsense Mutation detected in F1 DNA During 2016
sa37304 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101871 Nonsense 86 335 1 1
Genomic Location (Zv9):
Chromosome 21 (position 22072734)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22921147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTGCTCTTTACCCCTGCGGCTCACTTACTACGTACTGAACTCTCACT[G/A]GCCGTTCGGTCACATCGCCTGTCAGATCATCTTATATGTGTATTATCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37304
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101871 Nonsense 271 335 1 1
Genomic Location (Zv9):
Chromosome 21 (position 22072178)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22920591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACGGAGAGGCAGATCAAAATGAATGAATACAAAGAGTCGTGTGGCTA[T/A]ATATTGGCAGTGCGTAAGGCTGCGGTCATCACGCATTGCTTGTGCACGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link