ENSDARG00000069799

Ensembl ID:
ENSDARG00000069799
Human Orthologue:
HARBI1
Human Description:
harbinger transposase derived 1 [Source:HGNC Symbol;Acc:26522]
Mouse Orthologue:
Harbi1
Mouse Description:
harbinger transposase derived 1 Gene [Source:MGI Symbol;Acc:MGI:2443194]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9370 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111546 Nonsense 377 377 5 5
Genomic Location:
Chromosome 1 (position 28449638)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGACTATTTCGTCTCACCAGCTGGTAGCGTTCCTTGGCAGAACAAATA[T/A]GTTTAAGATAGTACAGATGTGGTGTCATAATCTTTATGTAAAGTCTTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ge3tdavz