crygm2d5

Ensembl ID:
ENSDARG00000069792
ZFIN ID:
ZDB-GENE-060918-4
Description:
crystallin, gamma M2d5 [Source:RefSeq peptide;Acc:NP_001038328]
Human Orthologues:
CRYGA, CRYGB, CRYGC, CRYGD
Human Descriptions:
crystallin, gamma A [Source:HGNC Symbol;Acc:2408]
crystallin, gamma B [Source:HGNC Symbol;Acc:2409]
crystallin, gamma C [Source:HGNC Symbol;Acc:2410]
crystallin, gamma D [Source:HGNC Symbol;Acc:2411]
Mouse Orthologues:
Cryga, Crygb, Crygc, Crygd, Cryge, Crygf
Mouse Descriptions:
crystallin, gamma A Gene [Source:MGI Symbol;Acc:MGI:88521]
crystallin, gamma B Gene [Source:MGI Symbol;Acc:MGI:88522]
crystallin, gamma C Gene [Source:MGI Symbol;Acc:MGI:88523]
crystallin, gamma D Gene [Source:MGI Symbol;Acc:MGI:88524]
crystallin, gamma E Gene [Source:MGI Symbol;Acc:MGI:88525]
crystallin, gamma F Gene [Source:MGI Symbol;Acc:MGI:88526]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7181 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101845 Essential Splice Site 2 173 1 3

The following transcripts of ENSDARG00000069792 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 23266069)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTTCTCCTTTGTGGAACCACTGAGGATCAGACAACGCAAACATGAAG[G/A]TAAACCTCATTTTAGCACCCATTCTATACAGTGAAACTTTWAAAATAAWT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/06mlgr3p