TMC6 (2 of 2)

Ensembl ID:
ENSDARG00000069787
Description:
transmembrane channel-like 6 [Source:HGNC Symbol;Acc:18021]
Human Orthologue:
TMC6
Human Description:
transmembrane channel-like 6 [Source:HGNC Symbol;Acc:18021]
Mouse Orthologue:
Tmc6
Mouse Description:
transmembrane channel-like gene family 6 Gene [Source:MGI Symbol;Acc:MGI:1098686]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10981 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10981
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101839 Nonsense 29 609 1 16
Genomic Location:
Chromosome 3 (position 58608608)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGTGCACAGCTGCTGCGGGAAATGCCTCTTAGTGTWTCTGAGAAGCGT[C/T]ARATGAGGTAAARSCAATGTAATACTGACTTTTGGATAMCGTTTGTTRAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dusgkj29