pvrl1a

Ensembl ID:
ENSDARG00000069767
ZFIN ID:
ZDB-GENE-090224-1
Description:
poliovirus receptor-related protein 1 [Source:RefSeq peptide;Acc:NP_001161042]
Human Orthologue:
PVRL1
Human Description:
poliovirus receptor-related 1 (herpesvirus entry mediator C) [Source:HGNC Symbol;Acc:9706]
Mouse Orthologue:
Pvrl1
Mouse Description:
poliovirus receptor-related 1 Gene [Source:MGI Symbol;Acc:MGI:1926483]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23926 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23926
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101782 Nonsense 3 219 2 3
ENSDART00000115224 Nonsense 3 475 3 7
Genomic Location (Zv9):
Chromosome 21 (position 21717414)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22565827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTATTGTTGTTAATCTTTCCCTTCCCAGGTGCTGATGGCCAAATGGTC[C/T]AGATGGAGAGCAGTAAGGCAGGATTTGTGGGTTCACAGGTGGAGTTGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link