etv5a

Ensembl ID:
ENSDARG00000069763
ZFIN ID:
ZDB-GENE-030131-9572
Description:
ETS translocation variant 5 [Source:RefSeq peptide;Acc:NP_001119933]
Human Orthologue:
ETV5
Human Description:
ets variant 5 [Source:HGNC Symbol;Acc:3494]
Mouse Orthologue:
Etv5
Mouse Description:
ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa279 Nonsense F2 line generated During 2014
sa16031 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa279
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101770 Nonsense 20 522 3 13
ENSDART00000126015 Nonsense 20 524 3 13
ENSDART00000139434 Nonsense 19 97 3 6
ENSDART00000145005 Nonsense 19 180 3 7
Genomic Location:
Chromosome 9 (position 23667593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAAAACTGGGTGACACTAACCAACGTGTTTTTCCATAGCAGAAGTCAT[T/A]GCAAGTGGAGGAACCATATAACAGACCAGTTAATGACAGAAAGAGAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16031
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101770 Nonsense 442 522 12 13
ENSDART00000126015 Nonsense 442 524 12 13
ENSDART00000139434 None None 97 None 6
ENSDART00000145005 None None 180 None 7
Genomic Location:
Chromosome 9 (position 23680454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGAACTAYGACAAGCTGAGTCGCTCACTGCGCTACTACTATGAGAAG[G/T]GAATCATGCAGAAGGTAAAGRCAGGTTCACCTTTTCCTKTACTTCGCACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Menarche (age at onset): Thirty new loci for age at menarche identified by a meta-analysis of genome-wide association studies. (View Study)
  • Weight: Genome-wide association yields new sequence variants at seven loci that associate with measures of obesity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rv9mpt0d