si:dkey-189g17.2

Ensembl ID:
ENSDARG00000069758
ZFIN ID:
ZDB-GENE-030131-5562
Description:
si:dkey-189g17.2 [Source:RefSeq peptide;Acc:NP_001122014]
Human Orthologue:
RBM44
Human Description:
RNA binding motif protein 44 [Source:HGNC Symbol;Acc:24756]
Mouse Orthologue:
Rbm44
Mouse Description:
RNA binding motif protein 44 Gene [Source:MGI Symbol;Acc:MGI:2685663]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21473 Nonsense Available for shipment Available now
sa9695 Nonsense Available for shipment Available now
sa1407 Nonsense Available for shipment Available now
sa21474 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21473
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101765 Nonsense 282 956 7 18
ENSDART00000136249   None 167 None 7
ENSDART00000139270   None 93 None 4

The following transcripts of ENSDARG00000069758 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23696458)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22852244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAGTAGAAAGCAGGGAAGATGCCAAACATTTTAAGGACACATCAGCC[C/T]AAGCGAGCTTCTGCCTCGATATGGAGCTTGATGTGCAGAGTCAGGTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9695
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101765 Nonsense 311 956 7 18
ENSDART00000136249   None 167 None 7
ENSDART00000139270   None 93 None 4

The following transcripts of ENSDARG00000069758 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23696547)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22852333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCAGGTTCAGAGAAATGACAACACCCAAAATAACCAAAAYCAATCATA[T/G]AATCCCACWGAAGAAAATGACYACAATGTGGACCAGGAAACCATGCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1407
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101765 Nonsense 886 956 18 18
ENSDART00000136249   None 167 None 7
ENSDART00000139270   None 93 None 4

The following transcripts of ENSDARG00000069758 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23705533)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22861319
KASP Assay ID:
554-1328.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAAAGGTTGACCAACGTGTGCAACTCGCCCACAGCCTCTGGAACATG[T/A]GTGCCACAGCACTACGCCACCATGGGAAGCTTCGACACAATCATGGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21474
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101765 Nonsense 889 956 18 18
ENSDART00000136249   None 167 None 7
ENSDART00000139270   None 93 None 4

The following transcripts of ENSDARG00000069758 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23705540)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22861326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTGACCAACGTGTGCAACTCGCCCACAGCCTCTGGAACATGTGTGCCA[C/T]AGCACTACGCCACCATGGGAAGCTTCGACACAATCATGGCCCGGCTGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link