MTMR11

Ensembl ID:
ENSDARG00000069755
Description:
myotubularin related protein 11 [Source:HGNC Symbol;Acc:24307]
Human Orthologue:
MTMR11
Human Description:
myotubularin related protein 11 [Source:HGNC Symbol;Acc:24307]
Mouse Orthologues:
Mtmr11, Sbf2
Mouse Descriptions:
myotubularin related protein 11 Gene [Source:MGI Symbol;Acc:MGI:2652817]
SET binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:1921831]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15856 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15856
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101753 Nonsense 400 814 13 18
Genomic Location:
Chromosome 16 (position 49131162)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTCCTCAGAGCCGGAGGWCCGGGACATGAAYTGTGTGGTCTGCAGTT[T/A]GGYTCAGGTGATGTGTGATCCTCACTGCCGGACCGTGGCTGGATTTCAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/onalt4fu