ENSDARG00000069754

Ensembl ID:
ENSDARG00000069754

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39641 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099354 Nonsense 32 320 1 4
ENSDART00000101749 Nonsense 28 317 1 4
ENSDART00000101750 Nonsense 23 246 1 2
Genomic Location (Zv9):
Chromosome 1 (position 34634590)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 34653268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTGATTGTCATCTGTGGACTGACTAAAGCTTCAATCAGACAGCATTA[T/A]TATGTGAATAGCTATAGGTCCTGGACTGAAGCTCAAAAATACTGCAGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link