cul5a

Ensembl ID:
ENSDARG00000069742
ZFIN ID:
ZDB-GENE-030131-5426
Description:
Vasopressin-activated calcium-mobilizing receptor (VACM-1) [Source:RefSeq peptide;Acc:NP_997871]
Human Orthologue:
CUL5
Human Description:
cullin 5 [Source:HGNC Symbol;Acc:2556]
Mouse Orthologue:
Cul5
Mouse Description:
cullin 5 Gene [Source:MGI Symbol;Acc:MGI:1922967]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22609 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22609
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101718 Essential Splice Site 438 541 13 16
ENSDART00000110111 Essential Splice Site 438 780 13 19
Genomic Location:
Chromosome 15 (position 16176242)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGTTGTCCTTAAAAGTGTTTCACAATACTATGAATGTCCTTTTGTA[G/A]CTACTAGTGCTTAAATACGTCCAGAATAAGGATGTGTTTATGAGGTACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2to5zso0