si:ch211-62a1.2

Ensembl ID:
ENSDARG00000069739
ZFIN ID:
ZDB-GENE-061207-40
Description:
Novel protein similar to rodent fibronectin type III domain containing 5 (Fndc5) [Source:UniProtKB/T
Human Orthologue:
FNDC5
Human Description:
fibronectin type III domain containing 5 [Source:HGNC Symbol;Acc:20240]
Mouse Orthologue:
Fndc5
Mouse Description:
fibronectin type III domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1917614]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10564 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10564
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101717 Nonsense 189 204 5 5
ENSDART00000141779 Nonsense 166 178 4 4
Genomic Location (Zv9):
Chromosome 13 (position 46353596)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 45649465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAACGARCCRAACAATAACAAGGATAAAGCCAAGAACTCGTCTGAATG[C/A]AGCACTCCAGAGCACACGTCAGGTGGCCTGCTGCGCAGTAAGGTATAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link