si:ch211-5k11.6

Ensembl ID:
ENSDARG00000069735
ZFIN ID:
ZDB-GENE-081104-38
Description:
hypothetical protein LOC497166 [Source:RefSeq peptide;Acc:NP_001013479]
Human Orthologues:
HBA1, HBA2, HBQ1, HBZ
Human Descriptions:
hemoglobin, alpha 1 [Source:HGNC Symbol;Acc:4823]
hemoglobin, alpha 2 [Source:HGNC Symbol;Acc:4824]
hemoglobin, theta 1 [Source:HGNC Symbol;Acc:4833]
hemoglobin, zeta [Source:HGNC Symbol;Acc:4835]
Mouse Orthologues:
F830116E18Rik, Hba-a1, Hba-a2, Hba-x, Hbq1
Mouse Descriptions:
hemoglobin alpha, adult chain 1 Gene [Source:MGI Symbol;Acc:MGI:96015]
hemoglobin alpha, adult chain 2 Gene [Source:MGI Symbol;Acc:MGI:96016]
hemoglobin X, alpha-like embryonic chain in Hba complex Gene [Source:MGI Symbol;Acc:MGI:96019]
hemoglobin, theta 1 Gene [Source:MGI Symbol;Acc:MGI:2685722]
RIKEN cDNA F830116E18 gene Gene [Source:MGI Symbol;Acc:MGI:3613460]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26158 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101709 Nonsense 39 143 2 3
Genomic Location (Zv9):
Chromosome 3 (position 55945509)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54839235
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGTGTAAACAATTATTCTCCTCCTTGCAGAATGCTTACTGTCTACCCA[C/T]AGACTAAAATATATTTCGCTCATTGGCCTGACCACTCTCTTGGATCTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link