rpz3

Ensembl ID:
ENSDARG00000069728
ZFIN ID:
ZDB-GENE-030131-4784
Description:
rapunzel 3 [Source:RefSeq peptide;Acc:NP_001104705]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17757 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17757
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101698 Nonsense 49 393 2 2
ENSDART00000132793 Nonsense 49 207 2 2
Genomic Location:
Chromosome 16 (position 49528118)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGCTGTWGGAGGAYTGAGTCCACTTTTTGAAGCTGCAGCTCCCGTCCTC[A/T]AACTCGTCCTCAACAACGTWGAAAGCAAGGAGGTCACATATGTCAAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ug9lg02g