glis3

Ensembl ID:
ENSDARG00000069726
ZFIN ID:
ZDB-GENE-070112-2232
Description:
zinc finger protein GLIS3 [Source:RefSeq peptide;Acc:NP_001074076]
Human Orthologue:
GLIS3
Human Description:
GLIS family zinc finger 3 [Source:HGNC Symbol;Acc:28510]
Mouse Orthologue:
Glis3
Mouse Description:
GLIS family zinc finger 3 Gene [Source:MGI Symbol;Acc:MGI:2444289]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17645 Nonsense Available for shipment Available now
sa1567 Nonsense F2 line generated During 2016
sa16572 Nonsense Available for shipment Available now
sa1286 Nonsense F2 line generated During 2016
sa41564 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085375 Nonsense 47 787 2 12
ENSDART00000142833 Nonsense 63 803 2 12
Genomic Location (Zv9):
Chromosome 10 (position 674426)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 671199
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACCAATGGAAAACWGGGCTTTCCACAGCCATCMCGAGCTCTTCATCAA[C/T]AGGCWCCACAGATTTCACTCCCAGCATCCTCCTCCTCCAAACAGTCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1567
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085375 Nonsense 219 787 4 12
ENSDART00000142833 Nonsense 235 803 4 12
Genomic Location (Zv9):
Chromosome 10 (position 663606)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 660379
KASP Assay ID:
554-1510.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCAGTAGTCCGCGCCTCTCGGCCCGCTCAAAGAAGCGAGCGCTGTCTT[T/A]ATCCCCACTATCGGATGGTTTGGGCCTGGACCTGAACTCCATCATCCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16572
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085375 Nonsense 541 787 7 12
ENSDART00000142833 Nonsense 557 803 7 12
Genomic Location (Zv9):
Chromosome 10 (position 648573)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 645346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCCAGCTCACTGCGGAAACACGTCAAATCTCACTCGCTGAAGGAGCAG[C/T]AGGCCCGGAAGAAGGTACKAGAGACAMCAACACACACAAGTCWGTCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1286
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085375 Nonsense 651 787 9 12
ENSDART00000142833 Nonsense 667 803 9 12
Genomic Location (Zv9):
Chromosome 10 (position 640714)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 637487
KASP Assay ID:
554-1201.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTCACCAGACNNNNNNNNNNNNNNNNNNTCAGACTCATCACATCCAG[C/T]AGATTCATCAGACTCACCTGACTCATCAGATCCAGCAGATTCACCAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41564
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085375 Nonsense 755 787 12 12
ENSDART00000142833 Nonsense 771 803 12 12
Genomic Location (Zv9):
Chromosome 10 (position 632080)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 628853
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGCTGTGTGTGTTTATGACAGCAGTGCTGGACTGCCAGAGCGGCCCT[C/T]AAGGCTTTATAGGAGAGCAGGAGCCCTCAGTGTCGGAGGACAATTATCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link