cdc34a

Ensembl ID:
ENSDARG00000069708
ZFIN ID:
ZDB-GENE-040426-713
Description:
ubiquitin-conjugating enzyme E2 R2 [Source:RefSeq peptide;Acc:NP_957252]
Human Orthologue:
CDC34
Human Description:
cell division cycle 34 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:1734]
Mouse Orthologues:
Cdc34, Cdc34-ps
Mouse Descriptions:
cell division cycle 34 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:102657]
cell division cycle 34 homolog, pseudogene (S. cerevisiae) Pseudogene [Source:MGI Symbol;Acc:MGI:185

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37511 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101659 Nonsense 90 241 2 5
ENSDART00000131129 Nonsense 90 263 2 6
Genomic Location (Zv9):
Chromosome 22 (position 22510672)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22122308
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCCTCCTGCCTTCAGATTCCTCACCAAGATGTGGCATCCCAACATCTA[T/A]GAGGTATGACCACACAAACGGCTGCCAGAACAGTGTTGTGCATGAAATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link