efhb

Ensembl ID:
ENSDARG00000069703
ZFIN ID:
ZDB-GENE-091001-1
Human Orthologue:
EFHB
Human Description:
EF-hand domain family, member B [Source:HGNC Symbol;Acc:26330]
Mouse Orthologue:
Efhb
Mouse Description:
EF hand domain family, member B Gene [Source:MGI Symbol;Acc:MGI:3045296]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14207 Nonsense Available for shipment Available now
sa19155 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14207
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101629 Nonsense 142 585 4 13
Genomic Location:
Chromosome 16 (position 53047090)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGTCACAAGTTCAAGGCCCTGGTTTACCAAGCTGGCTTAACCCCGAG[A/T]AAACTACKTTTGGTGTCACAACACTCTGTTGTAAGAGTAATAGTGAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19155
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101629 Nonsense 253 585 7 13
Genomic Location:
Chromosome 16 (position 53044646)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAATTAGTTCCGAAACGCTGCGACGACTTCAGAGAGAAGCCTCATCCA[C/T]AAATAGGCAAAGTTCATGATCCGTAAGTCATGATTAAGAGAATTTTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rhuiy93v