efhb

Ensembl ID:
ENSDARG00000069703
ZFIN ID:
ZDB-GENE-091001-1
Human Orthologue:
EFHB
Human Description:
EF-hand domain family, member B [Source:HGNC Symbol;Acc:26330]
Mouse Orthologue:
Efhb
Mouse Description:
EF hand domain family, member B Gene [Source:MGI Symbol;Acc:MGI:3045296]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14207 Nonsense Available for shipment Available now
sa19155 Nonsense Mutation detected in F1 DNA During 2016
sa36260 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14207
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101629 Nonsense 142 585 4 13
Genomic Location (Zv9):
Chromosome 16 (position 53047090)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 49419091
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGTCACAAGTTCAAGGCCCTGGTTTACCAAGCTGGCTTAACCCCGAG[A/T]AAACTACKTTTGGTGTCACAACACTCTGTTGTAAGAGTAATAGTGAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19155
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101629 Nonsense 253 585 7 13
Genomic Location (Zv9):
Chromosome 16 (position 53044646)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 49416647
KASP Assay ID:
2261-0343.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAATTAGTTCCGAAACGCTGCGACGACTTCAGAGAGAAGCCTCATCCA[C/T]AAATAGGCAAAGTTCATGATCCGTAAGTCATGATTAAGAGAATTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101629 Nonsense 276 585 8 13
Genomic Location (Zv9):
Chromosome 16 (position 53044473)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 49416474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAATTGCGGAGACATTAAACGTTCCCAGTGATCACACATTTGGAGTCT[T/A]GATGAAACCTGACAGCTTTGGTAATTTGAATAGTCTGTCACATTCTGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link