lgi2b

Ensembl ID:
ENSDARG00000069701
ZFIN ID:
ZDB-GENE-060217-3
Description:
leucine-rich repeat LGI family, member 2b [Source:RefSeq peptide;Acc:NP_001034731]
Human Orthologue:
LGI2
Human Description:
leucine-rich repeat LGI family, member 2 [Source:HGNC Symbol;Acc:18710]
Mouse Orthologue:
Lgi2
Mouse Description:
leucine-rich repeat LGI family, member 2 Gene [Source:MGI Symbol;Acc:MGI:2180196]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39651 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa13065 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39651
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101623 Splice Site, Nonsense 120 552 3 8
ENSDART00000113109 Splice Site, Nonsense 154 586 3 8
Genomic Location (Zv9):
Chromosome 1 (position 40416885)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39306294
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCTGAAATAAAGGAGGATGCATTCTCAGGGCTTCCTCATCTGGAGTA[T/A]TTGTAAGTATATGGGCAGCTTTACTCAACTCATGAGCAGAAATATCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13065
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101623 Essential Splice Site 225 552 6 8
ENSDART00000113109 Essential Splice Site 259 586 6 8
Genomic Location (Zv9):
Chromosome 1 (position 40420171)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39309580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCTATTAAAGGATGTCCCAGAAAAACACAGCAAGTGTGTCTCCACAG[G/A]TAACTATTTCKGTTCMTCCGATATCTCTGATTAGTTTTAGTTGAATCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link