aip

Ensembl ID:
ENSDARG00000069699
ZFIN ID:
ZDB-GENE-030131-6735
Description:
aryl hydrocarbon receptor interacting protein [Source:RefSeq peptide;Acc:NP_999877]
Human Orthologue:
AIP
Human Description:
aryl hydrocarbon receptor interacting protein [Source:HGNC Symbol;Acc:358]
Mouse Orthologue:
Aip
Mouse Description:
aryl-hydrocarbon receptor-interacting protein Gene [Source:MGI Symbol;Acc:MGI:109622]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6597 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016877 Nonsense 134 342 3 7
ENSDART00000101617 Nonsense 134 342 3 7

The following transcripts of ENSDARG00000069699 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 40395054)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGACAGAGACACTGCTGCGGGATCGCTCAGGTTCACTCGCATCACTCTT[T/A]AGGTCACCATGATCTGGATAAGTTGCAGTCCAATCCTCAGCCTCTGATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y01n44hy