lrguk

Ensembl ID:
ENSDARG00000069698
ZFIN ID:
ZDB-GENE-050419-232
Description:
leucine-rich repeats and guanylate kinase domain containing [Source:RefSeq peptide;Acc:NP_001116719
Human Orthologue:
LRGUK
Human Description:
leucine-rich repeats and guanylate kinase domain containing [Source:HGNC Symbol;Acc:21964]
Mouse Orthologue:
Lrguk
Mouse Description:
leucine-rich repeats and guanylate kinase domain containing Gene [Source:MGI Symbol;Acc:MGI:1921604]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20244 Nonsense Available for shipment Available now
sa10454 Essential Splice Site Available for shipment Available now
sa13998 Nonsense Available for shipment Available now
sa20245 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20244
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101613 Nonsense 184 730 7 20
Genomic Location:
Chromosome 4 (position 14891797)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGAAATATGATCAACAAAATTGAAAACCTCCAGACTCTCCACAACCTG[C/T]AAGTTCTGGATTTGTCCTGTAACCGGATTCAAAGCCTCACGGGTCTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10454
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101613 Essential Splice Site 242 730 9 20
Genomic Location:
Chromosome 4 (position 14892479)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGAGCTTAAAGTCATTAYYTGGTACTTCATGCCAAYTGCTTTCTTGC[A/T]GGACCATGATGATTATAGGAWAGCTGTCATCTTCCTCCTCCAGCACCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13998
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101613 Nonsense 361 730 12 20
Genomic Location:
Chromosome 4 (position 14895711)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTAGTGCYTGCCACACCACCAGGRRGCCCTATTTTGGMGAAGAGGAT[G/T]GACTWGACTATCACTTTGTCACWGAGGAAGAATTTCACAACATGATTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101613 Nonsense 421 730 14 20
Genomic Location:
Chromosome 4 (position 14896755)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATACCGGACATTTCTTGTGTTTGCTTCTACACCAGGGAGTGTTCAGCT[T/A]GAAGAACTCGTATTTTGAGCCCCGTTACGTCTTGCTGATTCCCAGCGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/amdc23v4